PbGEM-259604 transfection vector

Overview

Vector design ID PbGEM-259604
Target PBANKA_082620
Design type ko
Vector available to request yes
Phenotype data phenotype data view
Selection marker cassette 3xHA-hdhfr-yFCU
Species berghei
Intermediate stage vector PbGEM-int-259597
Library clone ID PbG02_B-4b11
Available clones 3

Design data

Location

Target gene location berg08:998167..999705
Region deleted by design berg08:998469..999709
Percent CDS deleted 79.2

Recombineering oligos and barcodes

Zeo/PheS cassette orientation R2R1
Barcode sequence TGTAATAATCC
recUpR2 primer sequence
ttacacatcatatatatatgtatatgtgtatatgcatgcgttaaaaaaaagtaattcgtgcgcgtcagtgtaataatccccgcctactgcgactataga
homology_region    barcode    cassette_primer
recDownR1 primer sequence
attggtttttttttcattaaataaaacacctgcacctctaggggaaggctaaggcgcataacgataccac
homology_region    cassette_primer

Quality-control: primers and fragment sizes

QCR1 primer sequence TTTCGTTGCTATCGTTTGGT
QCR2 primer sequence TGAGCATGGTCAGGTAAAAA
GT primer sequence TTGCATTACCAGTAGGTGCA
Genotyping primer combination GT + GW1
insert length unmodified clone 9.44 kb
insert length intermediate vector 10.14 kb
insert length transfection vector 11.67 kb

Warning/error messages for design

Design warnings recDown oligo: reduced length of substitution region
Design fatal errors none

Graphical Overview of design features

Design features shown in parasite wild-type genome

-

Intermediate stage vector (bacterial selection cassette) in parasite genome context

-

final PbGEM transfection vector integrated into parasite genome

-