PbGEM-039238 transfection vector

Overview

Vector design ID PbGEM-039238
Target PBANKA_103430
Design type ko
Vector available to request yes
Phenotype data phenotype data view
Selection marker cassette 3xHA-hdhfr-yFCU
Species berghei
Intermediate stage vector PbGEM-int-341604
Library clone ID PbG01-2411f05
Available clones 1

Design data

Location

Target gene location berg10:1360849..1364988
Region deleted by design berg10:1360849..1364988
Percent CDS deleted 100.0

Recombineering oligos and barcodes

Zeo/PheS cassette orientation R1R2
Barcode sequence --
recUpR1 primer sequence
agttattatattataaaaaataaactttaaaaatgtaatacatgaacaccaaggcgcataacgataccac
homology_region    cassette_primer
recDownR2 primer sequence
aaataaaatgtttatccaacgatagatatacatcgtgatttattactcatccgcctactgcgactataga
homology_region    cassette_primer

Quality-control: primers and fragment sizes

QCR1 primer sequence AGCCGAAGTAGTTGGACTGCTCA
QCR2 primer sequence GGAAGAAGTGAAGGGTCTGTGTCCA
GT primer sequence TGCATGTAGGTTTGAAGCCA
Genotyping primer combination GT + GW1
insert length unmodified clone 13.94 kb
insert length intermediate vector 11.71 kb
insert length transfection vector 13.24 kb

Warning/error messages for design

Design warnings none
Design fatal errors none

Graphical Overview of design features

Design features shown in parasite wild-type genome

-

Intermediate stage vector (bacterial selection cassette) in parasite genome context

-

final PbGEM transfection vector integrated into parasite genome

-