PbGEM-int-309594 intermediate stage vector with bacterial selection marker

Overview

Vector design ID PbGEM-int-309594
Vector available to request yes
Available clones (IDs) 224702
PbGEM transfection vectors list
Target PBANKA_124530
Species berghei
Design type tag
Library clone ID PbG01-2403c07

Design data

Location

Target gene location berg12:1683227..1690837
Region deleted by design berg12:1683227..1683229
Percent CDS deleted 0.0

Recombineering oligos and barcodes

Zeo/PheS cassette orientation R1R2
Barcode sequence GCATTGGTTGG
recUpR1 primer sequence
ctcaaaaggacccagttgaaaacactgaaaagaaatctttcaaaatatttaaggcgcataacgataccac
homology_region    cassette_primer
recDownR2 primer sequence
aacaaatgacgaaaaaaaaatacatatgtataatcattaaaaataaataagtaattcgtgcgcgtcaggcattggttggccgcctactgcgactataga
homology_region    barcode    cassette_primer

Quality-control: primers and fragment sizes

QCR1 primer sequence GGAGCAGTTCTCAGCAAAAAGCA
QCR2 primer sequence TGTAGATGGAGATTGATGAGGA
GT primer sequence TGGTAGGGCCTTGCATAGGTGA
insert length unmodified clone 9.85 kb
insert length intermediate vector 11.79 kb

Warning/error messages for design

Design warnings recDown oligo: Oligo has run of 9 As; recDown oligo: construct may infringe neighbouring 3' UTR region
Design fatal errors none

Graphical Overview of design features

Design features shown in parasite wild-type genome

-

Intermediate vector design in parasite genome

-