PbGEM-266100 transfection vector

Overview

Vector design ID PbGEM-266100
Target PBANKA_010110
Design type ko
Vector available to request yes
Phenotype data phenotype data view
Selection marker cassette 3xHA-hdhfr-yFCU
Species berghei
Intermediate stage vector PbGEM-int-266093
Library clone ID PbG02_B-64f02
Available clones 4

Design data

Location

Target gene location berg01:40254..41207
Region deleted by design berg01:40254..41009
Percent CDS deleted 79.2

Recombineering oligos and barcodes

Zeo/PheS cassette orientation R2R1
Barcode sequence CAGCGTGATGT
recUpR2 primer sequence
ttatagtcacacataaaataattttcctcctctaggccttcaaggcaaaagtaattcgtgcgcgtcagcagcgtgatgtccgcctactgcgactataga
homology_region    barcode    cassette_primer
recDownR1 primer sequence
ctcaagaatatattataataaattccattcgttttaaagtataagaatagaaggcgcataacgataccac
homology_region    cassette_primer

Quality-control: primers and fragment sizes

QCR1 primer sequence AGATGGTTGTGCTGCATTCTGT
QCR2 primer sequence ACAACTCAATGTCACAGAGT
GT primer sequence TCCTCCAAAGGCCGAAAACAGGT
Genotyping primer combination GT + GW2
insert length unmodified clone 6.72 kb
insert length intermediate vector 7.91 kb
insert length transfection vector 9.43 kb

Warning/error messages for design

Design warnings recDown oligo: reduced length of substitution region
Design fatal errors none

Graphical Overview of design features

Design features shown in parasite wild-type genome

-

Intermediate stage vector (bacterial selection cassette) in parasite genome context

-

final PbGEM transfection vector integrated into parasite genome

-