PbGEM-300555 transfection vector

Overview

Vector design ID PbGEM-300555
Target PBANKA_112230
Design type ko
Vector available to request yes
Phenotype data phenotype data view
Selection marker cassette 3xHA-hdhfr-yFCU
Species berghei
Intermediate stage vector PbGEM-int-300548
Library clone ID PbG02_B-77e05
Available clones 4

Design data

Location

Target gene location berg11:808319..809656
Region deleted by design berg11:808319..809656
Percent CDS deleted 100.0

Recombineering oligos and barcodes

Zeo/PheS cassette orientation R2R1
Barcode sequence CGACATTGAAG
recUpR2 primer sequence
catgaatataggaatagaaaagttgtaaatataaataaagacggacaaaagtaattcgtgcgcgtcagcgacattgaagccgcctactgcgactataga
homology_region    barcode    cassette_primer
recDownR1 primer sequence
tatatatatatatagcatagttgtaaaattataaaattttataaaaaataaaggcgcataacgataccac
homology_region    cassette_primer

Quality-control: primers and fragment sizes

QCR1 primer sequence TGGGGTATTGTTTTGCTTAACA
QCR2 primer sequence TACCTTGCCGGTCAGAAAAA
GT primer sequence GCATGATGCCGAATGCCCAA
Genotyping primer combination GT + GW2
insert length unmodified clone 6.83 kb
insert length intermediate vector 7.44 kb
insert length transfection vector 8.96 kb

Warning/error messages for design

Design warnings none
Design fatal errors none

Graphical Overview of design features

Design features shown in parasite wild-type genome

-

Intermediate stage vector (bacterial selection cassette) in parasite genome context

-

final PbGEM transfection vector integrated into parasite genome

-