PbGEM-272858 transfection vector

Overview

Vector design ID PbGEM-272858
Target PBANKA_041450
Design type ko
Vector available to request yes
Phenotype data phenotype data view
Selection marker cassette 3xHA-hdhfr-yFCU
Species berghei
Intermediate stage vector PbGEM-int-272851
Library clone ID PbG01-2466a06
Available clones 6

Design data

Location

Target gene location berg04:528819..529696
Region deleted by design berg04:528786..529696
Percent CDS deleted 100.0

Recombineering oligos and barcodes

Zeo/PheS cassette orientation R2R1
Barcode sequence GAAGCTAATGC
recUpR2 primer sequence
aaaaaaaatatttaagatccaagttaacaacatttgctcaataaaaaaaagtaattcgtgcgcgtcaggaagctaatgcccgcctactgcgactataga
homology_region    barcode    cassette_primer
recDownR1 primer sequence
tacggtaatgttatataatagccaatttatgtataactttttttttttttaaggcgcataacgataccac
homology_region    cassette_primer

Quality-control: primers and fragment sizes

QCR1 primer sequence TCCCCATAACGCCCCAGCCA
QCR2 primer sequence TCAAGCCCCTGCCTACCATTGT
GT primer sequence ACGCTCATTCGAACCATCTGT
Genotyping primer combination GT + GW1
insert length unmodified clone 9.39 kb
insert length intermediate vector 10.42 kb
insert length transfection vector 11.95 kb

Warning/error messages for design

Design warnings none
Design fatal errors none

Graphical Overview of design features

Design features shown in parasite wild-type genome

-

Intermediate stage vector (bacterial selection cassette) in parasite genome context

-

final PbGEM transfection vector integrated into parasite genome

-